Stem-loop sequence ssa-mir-9a-5

AccessionMI0026773 (change log)
DescriptionSalmo salar miR-9a-5 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   -uc               g     ---      
5'    uuugguuaucuagcu uauga   guguu 
      ||||||||||||||| |||||   |||| a
3'    aagccaauagaucga auacu   cauaa 
   uga               a     guc      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-9a-5p

Accession MIMAT0032721
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-9a-5-3p

Accession MIMAT0032726
Sequence

40 - 

auaaagcuagauaaccgaaagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1