Stem-loop sequence ssa-mir-9a-3

AccessionMI0026771 (change log)
DescriptionSalmo salar miR-9a-3 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc       a       g      uu 
5'     uuugguu ucuagcu uaugag  a
       ||||||| ||||||| ||||||  u
3'     aagccaa agaucga auacuu  a
   auga       g       a      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-9a-5p

Accession MIMAT0032721
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-9a-3-3p

Accession MIMAT0032724
Sequence

36 - 

uaaagcuagagaaccgaaagua

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1