Stem-loop sequence ssa-mir-9a-2

AccessionMI0026770 (change log)
DescriptionSalmo salar miR-9a-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc               g     gu  g 
5'     uuugguuaucuagcu uauga  gu a
       ||||||||||||||| |||||  ||  
3'     aagccaauagaucga auacu  cg u
   auga               a     gc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-9a-5p

Accession MIMAT0032721
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-9a-2-3p

Accession MIMAT0032723
Sequence

39 - 

uaaagcuagauaaccgaaagua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1