Stem-loop sequence ssa-mir-9a-1

AccessionMI0026769 (change log)
DescriptionSalmo salar miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   ---uc       a       g     -   u 
5'      uuugguu ucuagcu uauga guu a
        ||||||| ||||||| ||||| ||| u
3'      aagccaa agaucga auacu uag g
   uaugu       g       a     a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-9a-5p

Accession MIMAT0032721
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-9a-1-3p

Accession MIMAT0032722
Sequence

39 - 

uaaagcuagagaaccgaauguau

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1