Stem-loop sequence ssa-mir-92a-4

AccessionMI0026761 (change log)
DescriptionSalmo salar miR-92a-4 stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention ssa-mir-92a-4
(5 sentences)

Stem-loop
   --         g     u       g  a 
5'   agguuggga gggug cagugcu uu c
     ||||||||| ||||| ||||||| || u
3'   uccggcccu uucac guuaugg ag c
   ug         g     -       a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-92a-4-5p

Accession MIMAT0032710
Sequence

1 - 

agguugggaggggugucagugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-92a-3p

Accession MIMAT0032708
Sequence

37 - 

uauugcacuugucccggccugu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1