Stem-loop sequence ssa-mir-92a-1

AccessionMI0026758 (change log)
DescriptionSalmo salar miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention ssa-mir-92a-1
(5 sentences)

Stem-loop
   --             ca       u   ua 
5'   agguugggauagg  gcaaugc cau  c
     |||||||||||||  ||||||| |||  u
3'   uccggcccuguuc  cguuaug gua  u
   ug             -a       -   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-92a-5p

Accession MIMAT0032707
Sequence

1 - 

agguugggauaggcagcaaugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-92a-3p

Accession MIMAT0032708
Sequence

38 - 

uauugcacuugucccggccugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1