Stem-loop sequence ssa-let-7b-1

AccessionMI0026752 (change log)
DescriptionSalmo salar let-7b-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7b-1
(7 sentences)

Stem-loop
   --u                ug   ---  -----a    ugu 
5'    gagguaguagguugug  guu   uc      gggu   u
      ||||||||||||||||  |||   ||      ||||   a
3'    uuccgucauccaacau  caa   ag      cccg   u
   ccc                gu   uug  gacuac    uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7b-5p

Accession MIMAT0032701
Sequence

1 - 

ugagguaguagguugugugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7b-3p

Accession MIMAT0032702
Sequence

56 - 

cuguacaaccuacugccuuccc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1