Stem-loop sequence ssa-let-7a-1

AccessionMI0026740 (change log)
DescriptionSalmo salar let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7a-1
(6 sentences)

Stem-loop
   --u   g   u            ----  aga   a 
5'    gag uag agguuguauagu    uc   gug c
      ||| ||| ||||||||||||    ||   |||  
3'    uuc auc uccgacauguca    ag   cac a
   ccu   g   c            auag  -ga   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7a-5p

Accession MIMAT0032688
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7a-3p

Accession MIMAT0032689
Sequence

46 - 

cuguacagccuccuagcuuucc

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1