Stem-loop sequence ssa-mir-731

AccessionMI0026737 (change log)
DescriptionSalmo salar miR-731 stem-loop
Literature search

2 open access papers mention ssa-mir-731
(28 sentences)

Stem-loop
   -aa       uuuuc      au    aaaca 
5'    ugacacg     ucccgg  ugcc     c
      |||||||     ||||||  ||||     a
3'    acugugc     agggcc  acgg     c
   acg       -uuua      --    aauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-731-5p

Accession MIMAT0032682
Sequence

1 - 

aaugacacguuuucucccggauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-731-3p

Accession MIMAT0032683
Sequence

42 - 

caccgggaauuucgugucagca

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1