Stem-loop sequence ssa-mir-724-1

AccessionMI0026726 (change log)
DescriptionSalmo salar miR-724-1 stem-loop
Gene family MIPF0001616; mir-724
Literature search

1 open access papers mention ssa-mir-724-1
(5 sentences)

Stem-loop
   --          uu  c a     -aau a 
5'   uuaaagggaa  ug g cuguu    c a
     ||||||||||  || | |||||    | a
3'   aauuuuccuu  ac c gacaa    g c
   ag          cc  a c     gauu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-724-5p

Accession MIMAT0032671
Sequence

1 - 

uuaaagggaauuugcgacuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-724-3p

Accession MIMAT0032672
Sequence

39 - 

cagccacaccuuccuuuuaaga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1