Stem-loop sequence ssa-mir-489-1

AccessionMI0026714 (change log)
DescriptionSalmo salar miR-489-1 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
   --u              c       ---  uu 
5'    ggucguauguauga gucauuu   ac  c
      |||||||||||||| |||||||   ||   
3'    ucggcauguauacu cagugag   ug  a
   ucg              a       guu  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-489-5p

Accession MIMAT0032657
Sequence

1 - 

uggucguauguaugacgucauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-489-3p

Accession MIMAT0032658
Sequence

40 - 

ugacaucauauguacggcugcu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1