Stem-loop sequence ssa-mir-456-1

AccessionMI0026706 (change log)
DescriptionSalmo salar miR-456-1 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
   --    g     uc       acau ug   cc 
5'   gcag caucu  ccagccu    g  gau  a
     |||| |||||  |||||||    |  |||   
3'   uguu guaga  ggucgga    c  cua  g
   ac    g     uu       ---- gu   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-456-5p

Accession MIMAT0032645
Sequence

1 - 

gcaggcaucuucccagccuac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-456-3p

Accession MIMAT0032646
Sequence

41 - 

caggcugguuagaugguuguca

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1