Stem-loop sequence ssa-mir-455

AccessionMI0026705 (change log)
DescriptionSalmo salar miR-455 stem-loop
Gene family MIPF0000129; mir-455
Literature search

2 open access papers mention ssa-mir-455
(14 sentences)

Stem-loop
   ----         u      a   c   gaa 
5'     uaugugccc uggacu cau gug   g
       ||||||||| |||||| ||| |||    
3'     auauacggg accuga gua cac   g
   ucac         u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-455-5p

Accession MIMAT0032643
Sequence

1 - 

uaugugcccuuggacuacaucg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-455-3p

Accession MIMAT0032644
Sequence

39 - 

gcaguccaugggcauauacacu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1