Stem-loop sequence ssa-mir-430c

AccessionMI0026701 (change log)
DescriptionSalmo salar miR-430c stem-loop
Gene family MIPF0000003; mir-430
Literature search

1 open access papers mention ssa-mir-430c
(1 sentences)

Stem-loop
   -a    u       -     g    guuu 
5'   accc aacaaaa gcauu acug    u
     |||| ||||||| ||||| ||||     
3'   uggg uuguuuu cguga ugac    g
   ga    u       u     a    guuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-430c-5p

Accession MIMAT0032635
Sequence

1 - 

aacccuaacaaaagcauugacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-430c-3p

Accession MIMAT0032636
Sequence

37 - 

uaagugcuuuuuguuuggguag

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1