Stem-loop sequence ssa-mir-430b

AccessionMI0026700 (change log)
DescriptionSalmo salar miR-430b stem-loop
Literature search

1 open access papers mention ssa-mir-430b
(1 sentences)

Stem-loop
   --aa         --    a     c    uc 
5'     uucaacuug  agca cuuuc uuua  a
       |||||||||  |||| ||||| ||||   
3'     agguugaau  ucgu gaaag aaau  c
   uaug         ua    -     -    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-430b-5p

Accession MIMAT0032633
Sequence

1 - 

aauucaacuugagcaacuuuccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-430b-3p

Accession MIMAT0032634
Sequence

38 - 

aaagugcuauuaaguuggaguau

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1