Stem-loop sequence ssa-mir-430a

AccessionMI0026699 (change log)
DescriptionSalmo salar miR-430a stem-loop
Gene family MIPF0000003; mir-430
Literature search

1 open access papers mention ssa-mir-430a
(1 sentences)

Stem-loop
   -     g    -c       g   u  cua 
5'  uaccu aaca  uagcauu acu gu   u
    ||||| ||||  ||||||| ||| ||   a
3'  auggg uugu  aucguga uga cg   u
   g     g    uc       a   -  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-430a-5p

Accession MIMAT0032631
Sequence

1 - 

uaccugaacacuagcauugacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-430a-3p

Accession MIMAT0032632
Sequence

39 - 

uaagugcuacuuguugggguag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1