Stem-loop sequence ssa-mir-33a-1

AccessionMI0026690 (change log)
DescriptionSalmo salar miR-33a-1 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   --g          u         c  gg u 
5'    ugcauuguag ugcauugca ug  c g
      |||||||||| ||||||||| ||  | c
3'    acgugacguc guguaacgu ac  g a
   aug          u         -  ua g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-33a-5p

Accession MIMAT0032618
Sequence

1 - 

gugcauuguaguugcauugca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-33a-3p

Accession MIMAT0032619
Sequence

40 - 

caaugugucugcagugcagua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1