Stem-loop sequence ssa-mir-30e-3

AccessionMI0026685 (change log)
DescriptionSalmo salar miR-30e-3 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30e-3
(3 sentences)

Stem-loop
   --u           aca       auag  u 
5'    guaaacauccu   cucagcu    cc g
      |||||||||||   |||||||    || u
3'    cauuuguggga   gggucgg    gg a
   uuu           gag       --aa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30e-5p

Accession MIMAT0032611
Sequence

1 - 

uguaaacauccuacacucagcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30e-3-3p

Accession MIMAT0032613
Sequence

40 - 

cuggggagaggguguuuacuuu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1