Stem-loop sequence ssa-mir-30e-2

AccessionMI0026684 (change log)
DescriptionSalmo salar miR-30e-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30e-2
(3 sentences)

Stem-loop
   --u       u   a a       gugag   g 
5'    guaaaca ccu c cucagcu     uug a
      ||||||| ||| | |||||||     |||  
3'    cauuugu gga g gggucgg     gac a
   uuu       c   a a       ----a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30e-5p

Accession MIMAT0032611
Sequence

1 - 

uguaaacauccuacacucagcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30e-3p

Accession MIMAT0032612
Sequence

41 - 

cugggagaaggcuguuuacuuu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1