Stem-loop sequence ssa-mir-30d-2

AccessionMI0026682 (change log)
DescriptionSalmo salar miR-30d-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30d-2
(4 sentences)

Stem-loop
   ---           uu        -   -g      
5'    uguaaacaucc  gacugaaa gcu  guguu 
      |||||||||||  |||||||| |||  |||| u
3'    acguuuguagg  cugacuuu cgg  uauac 
   ucg           --        u   ga      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30d-5p

Accession MIMAT0032608
Sequence

1 - 

uguaaacauccuugacugaaagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30d-2-3p

Accession MIMAT0032610
Sequence

42 - 

uuuucagucggauguuugcagcu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1