Stem-loop sequence ssa-mir-30d-1

AccessionMI0026681 (change log)
DescriptionSalmo salar miR-30d-1 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30d-1
(4 sentences)

Stem-loop
   --           uu           -g      
5'   uguaaacaucc  gacugaaagcu  guguu 
     |||||||||||  |||||||||||  |||| u
3'   acguuuguagg  cugacuuucgg  cauac 
   cg           --           ga      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30d-5p

Accession MIMAT0032608
Sequence

1 - 

uguaaacauccuugacugaaagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30d-3p

Accession MIMAT0032609
Sequence

41 - 

cuuucagucggauguuugcagc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1