Stem-loop sequence ssa-mir-30c-2

AccessionMI0026680 (change log)
DescriptionSalmo salar miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

4 open access papers mention ssa-mir-30c-2
(8 sentences)

Stem-loop
   --           uu           gg    c 
5'   uguaaacaucc  gacuggaagcu  uguu g
     |||||||||||  |||||||||||  |||| g
3'   acguuuguagg  cugacuuucgg  gcga u
   cg           --           ga    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30c-5p

Accession MIMAT0032606
Sequence

1 - 

uguaaacauccuugacuggaagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30c-3p

Accession MIMAT0032607
Sequence

44 - 

cuuucagucggauguuugcagc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1