Stem-loop sequence ssa-mir-30b

AccessionMI0026678 (change log)
DescriptionSalmo salar miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30b
(3 sentences)

Stem-loop
   --u          ccg           u   gu 
5'    guaaacaucc   acuggaagcug gau  a
      ||||||||||   ||||||||||| |||   
3'    cguuuguggg   ugacuuucgau uug  c
   cgu          --a           c   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30b-5p

Accession MIMAT0032604
Sequence

1 - 

uguaaacauccccgacuggaagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30b-3p

Accession MIMAT0032605
Sequence

43 - 

cuuucaguaggguguuugcugc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1