Stem-loop sequence ssa-mir-30a-2

AccessionMI0026677 (change log)
DescriptionSalmo salar miR-30a-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30a-2
(3 sentences)

Stem-loop
   --u          ua       a  g  gcc 
5'    guaaacaucc  cacucuc gc gc   c
      ||||||||||  ||||||| || ||    
3'    cguuuguagg  gugaggg cg ug   u
   ucg          --       c  a  auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30a-5p

Accession MIMAT0032600
Sequence

1 - 

uguaaacauccuacacucucagc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30a-3p

Accession MIMAT0032603
Sequence

39 - 

ccgggagugggauguuugcgcu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1