Stem-loop sequence ssa-mir-30a-4

AccessionMI0026675 (change log)
DescriptionSalmo salar miR-30a-4 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30a-4
(3 sentences)

Stem-loop
   --u           aca         --   a 
5'    guaaacauccu   cucucagcu  gug c
      |||||||||||   |||||||||  |||  
3'    cauuugugggg   gagggucga  uac a
   ucg           --a         gc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30a-5p

Accession MIMAT0032600
Sequence

1 - 

uguaaacauccuacacucucagc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30a-4-3p

Accession MIMAT0032602
Sequence

39 - 

cugggagagggguguuuacgcu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1