Stem-loop sequence ssa-mir-30a-3

AccessionMI0026674 (change log)
DescriptionSalmo salar miR-30a-3 stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention ssa-mir-30a-3
(3 sentences)

Stem-loop
   --            aca         --   a 
5'   uguaaacauccu   cucucagcu  gug c
     ||||||||||||   |||||||||  |||  
3'   acauuugugggg   gagggucga  uac a
   uc            --a         gc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-30a-5p

Accession MIMAT0032600
Sequence

1 - 

uguaaacauccuacacucucagc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-30a-3-3p

Accession MIMAT0032601
Sequence

39 - 

cugggagagggguguuuacacu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1