Stem-loop sequence ssa-mir-29b-4

AccessionMI0026668 (change log)
DescriptionSalmo salar miR-29b-4 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --   au    uuu       -----     u 
5'   acc  uuuc   ugguguu     uagag c
     |||  ||||   |||||||     |||||  
3'   ugg  aaag   accacga     aucuc u
   au   cu    uuu       ucuuu     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-29b-4-5p

Accession MIMAT0032589
Sequence

1 - 

accauuuucuuuugguguuuag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-29b-3p

Accession MIMAT0032586
Sequence

38 - 

uagcaccauuugaaaucgguua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1