Stem-loop sequence ssa-mir-29b-3

AccessionMI0026667 (change log)
DescriptionSalmo salar miR-29b-3 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --         uuu       c    u uu 
5'   accgauuuc   ugguguu agag c  g
     |||||||||   ||||||| |||| |  u
3'   uggcuaaag   accacga ucuu g  u
   au         uuu       -    u ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-29b-3-5p

Accession MIMAT0032588
Sequence

1 - 

accgauuucuuuugguguucaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-29b-3p

Accession MIMAT0032586
Sequence

39 - 

uagcaccauuugaaaucgguua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1