Stem-loop sequence ssa-mir-29b-2

AccessionMI0026666 (change log)
DescriptionSalmo salar miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
              cuc       --u  a  ccc 
5' ugacugauuuc   ugguguu   ag gc   u
   |||||||||||   |||||||   || ||    
3' auuggcuaaag   accacga   uc cg   u
              uuu       ucu  -  aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-29b-2-5p

Accession MIMAT0032587
Sequence

1 - 

ugacugauuuccucugguguuuaga

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-29b-3p

Accession MIMAT0032586
Sequence

42 - 

uagcaccauuugaaaucgguua

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1