Stem-loop sequence ssa-mir-26d

AccessionMI0026656 (change log)
DescriptionSalmo salar miR-26d stem-loop
Gene family MIPF0000043; mir-26
Literature search

2 open access papers mention ssa-mir-26d
(5 sentences)

Stem-loop
   --u      a    a          g   a 
5'    ucaagu aucu ggauaggcuu uuu a
      |||||| |||| |||||||||| ||| g
3'    gguuca uagg cuuauccgag ggg c
   cuu      g    g          a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-26d-5p

Accession MIMAT0032571
Sequence

1 - 

uucaaguaaucuaggauaggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-26d-3p

Accession MIMAT0032572
Sequence

40 - 

ccuauucgggaugacuugguuc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1