Stem-loop sequence ssa-mir-26b

AccessionMI0026655 (change log)
DescriptionSalmo salar miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

3 open access papers mention ssa-mir-26b
(9 sentences)

Stem-loop
   --u      a  c            gu  a 
5'    ucaagu au caggauagguuu  uc g
      |||||| || ||||||||||||  || a
3'    gguuca ua gucuuauccgaa  gg a
   cuu      g  c            au  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-26b-5p

Accession MIMAT0032569
Sequence

1 - 

uucaaguaauccaggauagguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-26b-3p

Accession MIMAT0032570
Sequence

40 - 

ccuauucugcaugacuugguuc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1