Stem-loop sequence ssa-mir-25-3

AccessionMI0026648 (change log)
DescriptionSalmo salar miR-25-3 stem-loop
Gene family MIPF0000013; mir-25
Literature search

4 open access papers mention ssa-mir-25-3
(24 sentences)

Stem-loop
   --    g     uu g     u   agcca 
5'   aggc gagac  g gcaau gcc     u
     |||| |||||  | ||||| |||     u
3'   ucug cucug  c cguua cgg     c
   ag    g     uu a     -   cagac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-25-3-5p

Accession MIMAT0032562
Sequence

1 - 

aggcggagacuugggcaauugcc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-25-3p

Accession MIMAT0032561
Sequence

39 - 

cauugcacuugucucggucuga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1