Stem-loop sequence ssa-mir-25-2

AccessionMI0026647 (change log)
DescriptionSalmo salar miR-25-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

4 open access papers mention ssa-mir-25-2
(24 sentences)

Stem-loop
   --    g   u uu g     u   ag aau 
5'   aggc gag c  g gcaau gcc  c   c
     |||| ||| |  | ||||| |||  |    
3'   ucug cuc g  c cguua cgg  g   u
   ag    g   u uu a     -   -g aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-25-5p

Accession MIMAT0032560
Sequence

1 - 

aggcggagucuugggcaauugcc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-25-3p

Accession MIMAT0032561
Sequence

39 - 

cauugcacuugucucggucuga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1