Stem-loop sequence ssa-mir-222b

AccessionMI0026632 (change log)
DescriptionSalmo salar miR-222b stem-loop
Gene family MIPF0000051; mir-221
Literature search

1 open access papers mention ssa-mir-222b
(2 sentences)

Stem-loop
   u             -     auc    g  g 
5'  gcucaguagucag uguag   cugu gg c
    ||||||||||||| |||||   |||| ||  
3'  ugggucaucgguc acauc   gacg cu a
   c             u     ---    a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-222b-5p

Accession MIMAT0032542
Sequence

1 - 

ugcucaguagucaguguagauc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-222b-3p

Accession MIMAT0032543
Sequence

39 - 

agcuacaucuggcuacuggguc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1