Stem-loop sequence ssa-mir-222a-1

AccessionMI0026630 (change log)
DescriptionSalmo salar miR-222a-1 stem-loop
Gene family MIPF0000051; mir-221
Literature search

1 open access papers mention ssa-mir-222a-1
(4 sentences)

Stem-loop
   --u         g   -     auc   uau 
5'    gcucaguag cag uguag   cug   a
      ||||||||| ||| |||||   |||   a
3'    ugggucauc guc acauc   gac   u
   cuc         g   u     gac   uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-222a-5p

Accession MIMAT0032540
Sequence

1 - 

ugcucaguaggcaguguagauccu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-222a-3p

Accession MIMAT0032541
Sequence

39 - 

agcuacaucuggcuacugggucuc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1