Stem-loop sequence ssa-mir-221

AccessionMI0026629 (change log)
DescriptionSalmo salar miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

2 open access papers mention ssa-mir-221
(8 sentences)

Stem-loop
   --        u         auuucug      u 
5'   accuagca acaauguag       uguggu u
     |||||||| |||||||||       ||||||  
3'   ugggucgu uguuacauc       acauca a
   uu        c         ------g      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-221-3p

Accession MIMAT0032538
Sequence

1 - 

accuagcauacaauguagauuuc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-221-5p

Accession MIMAT0032539
Sequence

41 - 

agcuacauugucugcuggguuu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1