Stem-loop sequence ssa-mir-2188

AccessionMI0026617 (change log)
DescriptionSalmo salar miR-2188 stem-loop
Gene family MIPF0000812; mir-2188
Literature search

2 open access papers mention ssa-mir-2188
(18 sentences)

Stem-loop
   --a     ca          u   g g gg 
5'    agguc  accucacaug ccu u u  c
      |||||  |||||||||| ||| | |   
3'    uccag  uggagugugu gga g a  u
   cua     ac          c   a g ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-2188-5p

Accession MIMAT0032522
Sequence

1 - 

aagguccaaccucacauguccu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-2188-3p

Accession MIMAT0032523
Sequence

39 - 

gcugugugaggucagaccuauc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1