Stem-loop sequence ssa-mir-216a

AccessionMI0026614 (change log)
DescriptionSalmo salar miR-216a stem-loop
Literature search

1 open access papers mention ssa-mir-216a
(4 sentences)

Stem-loop
   --u       g    -   c     --ug  u 
5'    aaucucu cagg caa uguga    uc u
      ||||||| |||| ||| |||||    ||  
3'    uuggaga gucc guu acacu    gg a
   guc       g    a   -     cuuu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-216a-5p

Accession MIMAT0032516
Sequence

1 - 

uaaucucugcaggcaacuguga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-216a-3p

Accession MIMAT0032517
Sequence

39 - 

acauugaccuggagagguucug

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1