Stem-loop sequence ssa-mir-210-1

AccessionMI0026605 (change log)
DescriptionSalmo salar miR-210-1 stem-loop
Gene family MIPF0000086; mir-210
Literature search

1 open access papers mention ssa-mir-210-1
(4 sentences)

Stem-loop
       a   acua       u  c ccuauc 
5' agcc cug    acguaca ug g      c
   |||| |||    ||||||| || |      c
3' ucgg gac    ugcgugu ac c      a
       c   agug       c  - accuua 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-210-5p

Accession MIMAT0032508
Sequence

1 - 

agccacugacuaacguacauug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-210-3p

Accession MIMAT0032509
Sequence

43 - 

cugugcgugugacagcggcu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1