Stem-loop sequence ssa-mir-20b

AccessionMI0026604 (change log)
DescriptionSalmo salar miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-20b
(3 sentences)

Stem-loop
   ---ca      u    g     gua    a 
5'      aagugc caca ugcag   guuu a
        |||||| |||| |||||   ||||  
3'      uucacg gugu acguc   caag a
   ugaac      u    g     auc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-20b-5p

Accession MIMAT0032506
Sequence

1 - 

caaagugcucacagugcaggua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-20b-3p

Accession MIMAT0032507
Sequence

37 - 

acugcagugugugcacuucaagu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1