Stem-loop sequence ssa-mir-20a-3

AccessionMI0026603 (change log)
DescriptionSalmo salar miR-20a-3 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-20a-3
(6 sentences)

Stem-loop
   ---ua           g     g   uucua 
5'      aagugcuuaua ugcag uag     u
        ||||||||||| ||||| |||      
3'      uucacgagugu acguc auc     g
   uguag           g     -   uaccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-20a-5p

Accession MIMAT0032502
Sequence

1 - 

uaaagugcuuauagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-20a-3-3p

Accession MIMAT0032505
Sequence

38 - 

acugcagugugagcacuugaugu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1