Stem-loop sequence ssa-mir-20a-2

AccessionMI0026602 (change log)
DescriptionSalmo salar miR-20a-2 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-20a-2
(6 sentences)

Stem-loop
   ---ua           g     g   uuuua 
5'      aagugcuuaua ugcag uag     u
        ||||||||||| ||||| |||      
3'      uucacgagugu acguc auc     g
   ugaag           g     -   cauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-20a-5p

Accession MIMAT0032502
Sequence

1 - 

uaaagugcuuauagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-20a-2-3p

Accession MIMAT0032504
Sequence

38 - 

acugcagugugagcacuugaagu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1