Stem-loop sequence ssa-mir-20a-1

AccessionMI0026601 (change log)
DescriptionSalmo salar miR-20a-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-20a-1
(6 sentences)

Stem-loop
   ---ua           g     -----    uau 
5'      aagugcuuaua ugcag     guag   a
        ||||||||||| |||||     ||||    
3'      uucacgagugu acguc     cauc   u
   ugacc           a     aucua    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-20a-5p

Accession MIMAT0032502
Sequence

1 - 

uaaagugcuuauagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-20a-1-3p

Accession MIMAT0032503
Sequence

40 - 

acugcaaugugagcacuuccagu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1