Stem-loop sequence ssa-mir-202

AccessionMI0026586 (change log)
DescriptionSalmo salar miR-202 stem-loop
Gene family MIPF0000121; mir-202
Literature search

1 open access papers mention ssa-mir-202
(11 sentences)

Stem-loop
   u        -a   a  g       au 
5'  uccuaugc  uau cc cuuugag  c
    ||||||||  ||| || |||||||  u
3'  aggguacg  aua gg gaaauuu  a
   a        gg   c  a       cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-202-3p

Accession MIMAT0032481
Sequence

1 - 

uuccuaugcauauaccgcuuuga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-202-5p

Accession MIMAT0032482
Sequence

35 - 

aaagaggcauagggcaugggaa

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1