Stem-loop sequence ssa-mir-199a-1

AccessionMI0026565 (change log)
DescriptionSalmo salar miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   -c       u        c   ---    gg 
5'   ccagugu cagacuac ugu   ucag  u
     ||||||| |||||||| |||   ||||  c
3'   gguuaca gucugaug aca   gguc  u
   uu       c        -   ugu    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-199a-5p

Accession MIMAT0032460
Sequence

1 - 

cccaguguucagacuaccuguuc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-199a-3p

Accession MIMAT0032461
Sequence

40 - 

acaguagucugcacauugguu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1