Stem-loop sequence ssa-mir-196b-2

AccessionMI0026564 (change log)
DescriptionSalmo salar miR-196b-2 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   --            a   g   ---g  ug 
5'   uagguaguuuca guu uug    gc  g
     |||||||||||| ||| |||    ||  a
3'   guccaucaaagu caa gac    ug  c
   aa            c   g   acua  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-196b-5p

Accession MIMAT0032458
Sequence

1 - 

uagguaguuucaaguuguuggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-196b-3p

Accession MIMAT0032459
Sequence

37 - 

caggaaccugaaacuaccugaa

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1