Stem-loop sequence ssa-mir-196a-2

AccessionMI0026560 (change log)
DescriptionSalmo salar miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   -   gu      a      u   aucca 
5'  uag  aguuuc uguugu ggg     u
    |||  |||||| |||||| |||     u
3'  guc  ucaaag acaaca cuc     u
   a   ug      c      u   caucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-196a-5p

Accession MIMAT0032453
Sequence

1 - 

uagguaguuucauguuguuggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-196a-2-3p

Accession MIMAT0032455
Sequence

38 - 

cuacaacacgaaacugucuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1