Stem-loop sequence ssa-mir-196a-1

AccessionMI0026559 (change log)
DescriptionSalmo salar miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   --u         ca          auu a 
5'    agguaguuu  uguuguuggg   g c
      |||||||||  ||||||||||   | u
3'    uccgucaaa  acaacggcuc   c u
   agu         aa          ggu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-196a-5p

Accession MIMAT0032453
Sequence

1 - 

uagguaguuucauguuguuggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-196a-1-3p

Accession MIMAT0032454
Sequence

37 - 

ucggcaacaaaaaacugccuuga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1