Stem-loop sequence ssa-mir-194c

AccessionMI0026558 (change log)
DescriptionSalmo salar miR-194c stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   --u         a      a      agc 
5'    guaacagca cuccau uggaau   u
      ||||||||| |||||| ||||||    
3'    uauugucgu gaggug accuug   c
   ggg         c      -      gga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-194c-5p

Accession MIMAT0032451
Sequence

1 - 

uguaacagcaacuccauaugga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-194c-3p

Accession MIMAT0032452
Sequence

36 - 

ccaguggagcugcuguuauggg

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1