Stem-loop sequence ssa-mir-190a

AccessionMI0026549 (change log)
DescriptionSalmo salar miR-190a stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention ssa-mir-190a
(6 sentences)

Stem-loop
   --u                ua     uuau 
5'    gauauguuugauauau  gguug    u
      ||||||||||||||||  |||||     
3'    uuauacaaacuauaua  ucaac    c
   ucc                --     cuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-190a-5p

Accession MIMAT0032436
Sequence

1 - 

ugauauguuugauauauuagguug

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-190a-3p

Accession MIMAT0032437
Sequence

37 - 

acuauauaucaaacauauuccu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1